© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa03LNT0462900.1
CCATCCGTCCCAAAATAAGCACAACTATGAGTTTCCGTGTCCAACTTTGATCGTTCATCTTAATTAATTTTTTTTTAAAAAAAAATAAAAAACATAATTTACACATAAAGTACTATTCATGTTTTATAATCTTACAACAACAAAAATACTAATAAAAAAATTAAATAAGATGTACGATCAAAATTGGATACTGAAACTAATGGCTGTACTTATTTTGGAACTGGG
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa03LNT0462900.1 | osa-miR812p | Cleavage | 2.5 | 7.871 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812s | Translation | 5.0 | 8.279 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR5799 | Translation | 5.0 | 8.279 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812t | Cleavage | 4.5 | 6.903 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812u | Cleavage | 4.5 | 6.903 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812a | Cleavage | 5.0 | 7.871 | 1 | 22 |
| Osa03LNT0462900.1 | osa-miR812b | Cleavage | 5.0 | 7.871 | 1 | 22 |
| Osa03LNT0462900.1 | osa-miR812c | Cleavage | 5.0 | 7.871 | 1 | 22 |
| Osa03LNT0462900.1 | osa-miR812d | Cleavage | 5.0 | 7.871 | 1 | 22 |
| Osa03LNT0462900.1 | osa-miR812e | Cleavage | 5.0 | 7.871 | 1 | 22 |
| Osa03LNT0462900.1 | osa-miR812f | Cleavage | 3.0 | 7.387 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR1862e | Cleavage | 4.5 | 6.671 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812g | Cleavage | 3.0 | 8.279 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812h | Cleavage | 3.0 | 8.279 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812i | Cleavage | 3.0 | 8.279 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812j | Cleavage | 3.0 | 8.279 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812k | Cleavage | 2.5 | 7.387 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812l | Cleavage | 2.5 | 7.387 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812m | Cleavage | 2.5 | 7.387 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812n-5p | Cleavage | 1.5 | 11.098 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812n-3p | Cleavage | 4.5 | 6.903 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR812o-3p | Cleavage | 3.5 | 6.619 | 1 | 24 |
| Osa03LNT0462900.1 | osa-miR5505 | Cleavage | 5.0 | 10.048 | 1 | 22 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa03LNT0462900.1 | 3 | rn3 | Resistance or Tolerance | Drought tolerance | RM231 | RM175 |
| Osa03LNT0462900.1 | 3 | qDEF-3 | Physiological trait | Flowering | R518 | C721 |
| Osa03LNT0462900.1 | 3 | QSbr3a | Resistance or Tolerance | Sheath blight resistance | RG348 | RG944 |
| Osa03LNT0462900.1 | 3 | qtl3.1 | Resistance or Tolerance | Drought tolerance | RM7332 | RM545 |
| Osa03LNT0462900.1 | 3 | QSs3 | Physiological trait | Sterility | RG348 | RG944 |
| Osa03LNT0462900.1 | 3 | dth3.1 | Resistance or Tolerance | Drought tolerance | RG104 | RZ329 |
| Osa03LNT0462900.1 | 3 | nan | Resistance or Tolerance | Drought tolerance | RG348 | RZ329 |
| Osa03LNT0462900.1 | 3 | nan | Resistance or Tolerance | Drought tolerance | RM231 | RZ329 |
| Osa03LNT0462900.1 | 3 | nan | Resistance or Tolerance | Drought tolerance | RM231 | RZ329 |
| Osa03LNT0462900.1 | 3 | nan | Resistance or Tolerance | Drought tolerance | RM231 | RZ329 |
| Osa03LNT0462900.1 | 3 | qFDN-3 | Physiological trait | Flowering | RZ329 | RG348 |
| Osa03LNT0462900.1 | 3 | nan | Morphological trait | Root | CDO20 | RG409 |
| Osa03LNT0462900.1 | 3 | qOE3-1 | Physiological trait | Eating quality | nan | nan |
| Osa03LNT0462900.1 | 3 | qHEJ-3 | Morphological trait | Shoot/Seedling | RM175 | RM22 |
| Osa03LNT0462900.1 | 3 | S34(t) | Physiological trait | Sterility | nan | nan |
| Osa03LNT0462900.1 | 3 | qTA3 | Physiological trait | Eating quality | nan | nan |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)