© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa04LNT0492300.1
ACTAGCTCCATATTTTAATGTATGACGCCGTTGACTTTTCATCCAACGTTTGACCATTCGTCTTGTTCAAAAAATTTATGTAATTATCATTTATTTTATTGTGACTTGATTCATCATCAAATGATCTTTAAGCATGACATAAATATTTTCATATTTTCACAAAAAAATTGAATAAAACGAATGGTTAAACGTTGATAAAAAGTCAACGGTGTCATACATTAAAATACGGAGAGAGT
| Transcript ID | Transposon ID | Chromosome | Strand | Start | End | Counts |
|---|---|---|---|---|---|---|
| Osa04LNT0492300.1 | DTM_#DNAt_MULE_japo_Os0037 | Chr4 | - | 17732948 | 17734823 | 235 |
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa04LNT0492300.1 | osa-miR812s | Translation | 3.5 | 10.986 | 1 | 24 |
| Osa04LNT0492300.1 | osa-miR5799 | Translation | 2.0 | 10.986 | 1 | 24 |
| Osa04LNT0492300.1 | osa-miR443 | Translation | 4.0 | 14.722 | 1 | 22 |
| Osa04LNT0492300.1 | osa-miR812a | Cleavage | 2.5 | 10.542 | 1 | 22 |
| Osa04LNT0492300.1 | osa-miR812b | Cleavage | 2.5 | 10.542 | 1 | 22 |
| Osa04LNT0492300.1 | osa-miR812c | Cleavage | 2.5 | 10.542 | 1 | 22 |
| Osa04LNT0492300.1 | osa-miR812d | Cleavage | 2.5 | 10.542 | 1 | 22 |
| Osa04LNT0492300.1 | osa-miR812e | Cleavage | 2.5 | 10.542 | 1 | 22 |
| Osa04LNT0492300.1 | osa-miR1428e-3p | Translation | 5.0 | 11.723 | 1 | 21 |
| Osa04LNT0492300.1 | osa-miR812g | Translation | 4.0 | 10.986 | 1 | 24 |
| Osa04LNT0492300.1 | osa-miR812h | Translation | 4.0 | 10.986 | 1 | 24 |
| Osa04LNT0492300.1 | osa-miR812i | Translation | 4.0 | 10.986 | 1 | 24 |
| Osa04LNT0492300.1 | osa-miR812j | Translation | 4.0 | 10.986 | 1 | 24 |
| Osa04LNT0492300.1 | osa-miR812k | Cleavage | 4.0 | 9.521 | 1 | 24 |
| Osa04LNT0492300.1 | osa-miR812l | Cleavage | 4.0 | 9.521 | 1 | 24 |
| Osa04LNT0492300.1 | osa-miR812m | Cleavage | 4.0 | 9.521 | 1 | 24 |
| Osa04LNT0492300.1 | osa-miR812o-3p | Cleavage | 4.0 | 11.728 | 1 | 24 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa04LNT0492300.1 | 4 | An8-glum | Morphological trait | Panicle/flower | nan | nan |
| Osa04LNT0492300.1 | 4 | nan | Morphological trait | Root | RZ69 | RG449 |
| Osa04LNT0492300.1 | 4 | nan | Morphological trait | Root | RZ69 | RG449 |
| Osa04LNT0492300.1 | 4 | qCCFJ-4 | Physiological trait | Source activity | RM261 | RM3785 |
| Osa04LNT0492300.1 | 4 | gwt4a | Morphological trait | Seed | RG788 | RG190 |
| Osa04LNT0492300.1 | 4 | spp4-2 | Morphological trait | Panicle/flower | RG449 | CDO456 |
| Osa04LNT0492300.1 | 4 | gwt4a | Morphological trait | Seed | RG788 | RG190 |
| Osa04LNT0492300.1 | 4 | nan | Morphological trait | Panicle/flower | RG788 | RZ69 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)