© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa01LNT0461600.1
AATAGGTAACGCCGTTGACTTTTTCTCACATGTTTGACCATTCGTCTTATTCAAAAAATTTATGCAAATGTATAAGATATAAATCACACTTAAAGTACTATGAGTGATAAAACAACTCATAACAAAATAAATTATAATTACGTAAATTTTTTGAATAAGACGAATAGTCAAACATGTGAGAAAAAGTCAACGGCGTCATCTATT
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa01LNT0461600.1 | osa-miR5799 | Translation | 2.5 | 8.099 | 1 | 24 |
| Osa01LNT0461600.1 | osa-miR5824 | Cleavage | 5.0 | 8.758 | 1 | 24 |
| Osa01LNT0461600.1 | osa-miR169i-3p | Translation | 4.5 | 11.687 | 1 | 22 |
| Osa01LNT0461600.1 | osa-miR812a | Cleavage | 5.0 | 5.796 | 1 | 22 |
| Osa01LNT0461600.1 | osa-miR812b | Cleavage | 5.0 | 5.796 | 1 | 22 |
| Osa01LNT0461600.1 | osa-miR812c | Cleavage | 5.0 | 5.796 | 1 | 22 |
| Osa01LNT0461600.1 | osa-miR812d | Cleavage | 5.0 | 5.796 | 1 | 22 |
| Osa01LNT0461600.1 | osa-miR812e | Cleavage | 5.0 | 5.796 | 1 | 22 |
| Osa01LNT0461600.1 | osa-miR1442 | Cleavage | 3.5 | 13.864 | 1 | 20 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa01LNT0461600.1 | 1 | brt1d | Resistance or Tolerance | Drought tolerance | C742 | C904 |
| Osa01LNT0461600.1 | 1 | rfw1b | Resistance or Tolerance | Drought tolerance | C813 | C955 |
| Osa01LNT0461600.1 | 1 | Pi35(t) | Resistance or Tolerance | Blast resistance | RM1216 | RM1003 |
| Osa01LNT0461600.1 | 1 | nan | Resistance or Tolerance | Insect resistance | RM543 | RM472 |
| Osa01LNT0461600.1 | 1 | dth1.1 | Physiological trait | Flowering | RG541 | RG109 |
| Osa01LNT0461600.1 | 1 | ng1 | Morphological trait | Panicle/flower | RG374 | RG394 |
| Osa01LNT0461600.1 | 1 | sf1 | Physiological trait | Source activity | RG374 | RG394 |
| Osa01LNT0461600.1 | 1 | ng1 | Morphological trait | Seed | RG374 | RG394 |
| Osa01LNT0461600.1 | 1 | An10 | Morphological trait | Panicle/flower | nan | nan |
| Osa01LNT0461600.1 | 1 | sf1 | Morphological trait | Seed | RG374 | RG394 |
| Osa01LNT0461600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RG690 | RG810 |
| Osa01LNT0461600.1 | 1 | nan | Physiological trait | Source activity | RG374 | RG690 |
| Osa01LNT0461600.1 | 1 | nan | Physiological trait | Source activity | RG532 | RM472 |
| Osa01LNT0461600.1 | 1 | nan | Morphological trait | Root | RM212 | R2417 |
| Osa01LNT0461600.1 | 1 | qLEJ-1 | Morphological trait | Shoot/Seedling | RM212 | RM297 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)