© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa03LNT0466700.1
GATTTCAACTGAAAAAGTCATCAACAACAAAGTTGTATAACTCATCAAGATATATAACTTTTATTTTGGTCATTTCTTCATCCGACAAAGTGTTAGTAACATTGTTTACAAAAATTACATATATGTGTTATAGTTTAATCATTTAGTATTTTAAAATATTGTTTGAAGTTGTCATACTTTCAAATTCAAATTCAAACTGTTTAAAAAAATGTTGTATAGAAAAATGAACAAAATAAAAGTTATAGATATTGATGAGTTATGCAACTTTTTTGTTGATGACTTTTTCAGTTGAAATC
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa03LNT0466700.1 | osa-miR821a | Cleavage | 0.0 | 16.829 | 1 | 24 |
| Osa03LNT0466700.1 | osa-miR821a | Translation | 4.5 | 13.66 | 1 | 24 |
| Osa03LNT0466700.1 | osa-miR821b | Cleavage | 0.0 | 16.829 | 1 | 24 |
| Osa03LNT0466700.1 | osa-miR821b | Translation | 4.5 | 13.66 | 1 | 24 |
| Osa03LNT0466700.1 | osa-miR821c | Cleavage | 0.0 | 16.829 | 1 | 24 |
| Osa03LNT0466700.1 | osa-miR821c | Translation | 4.5 | 13.66 | 1 | 24 |
| Osa03LNT0466700.1 | osa-miR810b.2 | Translation | 4.0 | 7.709 | 1 | 21 |
| Osa03LNT0466700.1 | osa-miR2873a | Translation | 3.5 | 10.911 | 1 | 24 |
| Osa03LNT0466700.1 | osa-miR5157a-5p | Cleavage | 4.5 | 13.299 | 1 | 24 |
| Osa03LNT0466700.1 | osa-miR5157b-5p | Cleavage | 4.5 | 13.299 | 1 | 24 |
| Osa03LNT0466700.1 | osa-miR5162 | Cleavage | 5.0 | 13.66 | 1 | 24 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa03LNT0466700.1 | 3 | qGL-3 | Morphological trait | Seed | R19 | C1677 |
| Osa03LNT0466700.1 | 3 | qLWR-3 | Morphological trait | Seed | R19 | C1677 |
| Osa03LNT0466700.1 | 3 | ccf3b | Physiological trait | Source activity | RM16 | RM282 |
| Osa03LNT0466700.1 | 3 | ccfs3 | Physiological trait | Source activity | RM16 | RM282 |
| Osa03LNT0466700.1 | 3 | nan | Resistance or Tolerance | Other stress resistance | RM4512 | RM8208 |
| Osa03LNT0466700.1 | 3 | nan | Resistance or Tolerance | Other stress resistance | RM4512 | RM8208 |
| Osa03LNT0466700.1 | 3 | qDLR3 | Resistance or Tolerance | Other soil stress tolerance | RM338 | RM2453 |
| Osa03LNT0466700.1 | 3 | qGL3-1 | Physiological trait | Eating quality | nan | nan |
| Osa03LNT0466700.1 | 3 | nan | Morphological trait | Shoot/Seedling | RZ284 | RZ403 |
| Osa03LNT0466700.1 | 3 | An5(t) | Morphological trait | Panicle/flower | C1677 | R19 |
| Osa03LNT0466700.1 | 3 | nan | Morphological trait | Panicle/flower | RZ452 | RZ284 |
| Osa03LNT0466700.1 | 3 | gw3.1 | Morphological trait | Seed | RZ672 | RZ474 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)