© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa04LNT0282200.1
GGAGAAGAGGGCACCGACCACCGAGCCGGCAGCGGGCGGCGCCAACCGGGAAGGCGGTTCGTCCGCCACCGCGAGCGCGCGAGGTGGCGCGGCGGCGGCGTCAGCGCCGGTGTTGCCAGGCGAGAGAGCTAGTGGTTCCGCGTGTCCGGGGAGCAGACGTATCACGGATTCACCACATCGTGGCAGGGCAGTCCTTCGGTGCTGCGGGAGCACTTTGGTTTGGAGACCTTCCGCCAAACGAAGATGGACTTTCAGAGACCTGAACAAGCATAGCAGAATGACATTTATCGTCATGTTCATGGAGAATGTGGGGCAATTGCTAGAGAAAACATCATGAGACGGCGCATACCTGCAGGAGAGCCGGCGAGTCGAAGTGCTTGATGAAGCAAGTCAGCACGCACAGGGCATTTGCTAGTCTTCAGGAGAACCACTTGCAACG
| Transcript ID | Chromosome | Locus | Ref | Alt |
|---|---|---|---|---|
| Osa04LNT0282200.1 | 4 | 32183791 | A | T |
| Osa04LNT0282200.1 | 4 | 32183908 | A | C |
| Osa04LNT0282200.1 | 4 | 32184412 | C | T |
| Osa04LNT0282200.1 | 4 | 32184699 | A | G |
| Osa04LNT0282200.1 | 4 | 32185732 | C | T |
| Osa04LNT0282200.1 | 4 | 32185953 | C | T |
| Osa04LNT0282200.1 | 4 | 32187001 | G | C |
| Osa04LNT0282200.1 | 4 | 32187344 | C | T |
| Osa04LNT0282200.1 | 4 | 32186432 | A | G |
| Osa04LNT0282200.1 | 4 | 32187406 | G | C |
| Osa04LNT0282200.1 | 4 | 32187412 | T | C |
| Osa04LNT0282200.1 | 4 | 32187507 | C | T |
| Osa04LNT0282200.1 | 4 | 32187602 | G | A |
| Osa04LNT0282200.1 | 4 | 32187670 | G | A |
| Osa04LNT0282200.1 | 4 | 32188022 | A | G |
| Osa04LNT0282200.1 | 4 | 32188437 | A | G |
| Osa04LNT0282200.1 | 4 | 32188468 | A | G |
| Transcript ID | Transposon ID | Chromosome | Strand | Start | End | Counts |
|---|---|---|---|---|---|---|
| Osa04LNT0282200.1 | DTM_#DNAt_MULE_japo_Os2159 | Chr4 | + | 32187345 | 32188535 | 1190 |
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa04LNT0282200.1 | osa-miR2872 | Translation | 5.0 | 21.417 | 1 | 21 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa04LNT0282200.1 | 4 | qSHT-4 | Morphological trait | Panicle/flower | CDO244 | RG214 |
| Osa04LNT0282200.1 | 4 | nan | Morphological trait | Root | RG476 | RG214 |
| Osa04LNT0282200.1 | 4 | nan | Morphological trait | Root | RG476 | RG214 |
| Osa04LNT0282200.1 | 4 | OsAOX1a | Resistance or Tolerance | Cold tolerance | R2737 | R740 |
| Osa04LNT0282200.1 | 4 | pss4.1 | Physiological trait | Source activity | RZ740 | RZ590 |
| Osa04LNT0282200.1 | 4 | phc4.1 | Resistance or Tolerance | Drought tolerance | RG476 | RG214 |
| Osa04LNT0282200.1 | 4 | phs4.1 | Resistance or Tolerance | Drought tolerance | RG476 | RG214 |
| Osa04LNT0282200.1 | 4 | nan | Morphological trait | Panicle/flower | RM303 | RM348 |
| Osa04LNT0282200.1 | 4 | qSN-4b | Resistance or Tolerance | Drought tolerance | RM255 | RM349 |
| Osa04LNT0282200.1 | 4 | Xa2 | Resistance or Tolerance | Bacterial blight resistance | RM317 | RM349 |
| Osa04LNT0282200.1 | 4 | rfw4a | Resistance or Tolerance | Drought tolerance | RM349 | RM1136 |
| Osa04LNT0282200.1 | 4 | nan | Morphological trait | Root | RM3276 | RM3335 |
| Osa04LNT0282200.1 | 4 | gpp4 | Morphological trait | Seed | RZ569 | RZ565 |
| Osa04LNT0282200.1 | 4 | nan | Physiological trait | Source activity | RG143 | RG329 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)