© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa01LNT0052600.1
GTGATATTAATTAGGAGTAAAAGATTAGCACAACATGTCGATCGCCTGCACGTTGTATTACTGCAATTTAATCCCCTGTTCTTGATACAACATCGTACCAAGTACAGCATTAGCAATATATGTTTTCAGGACACGTACTATATAGTGGGACGATGCCATTTCGGTCTCTTTGTATCCATCTTAATTTACCATTACGACGTAAGTACGCACTTCGCTGCAGTAGTTGTCAACTTCTGTCCAATCCACAATCCACTGCATCCCTTTTTCTTAGAGGTTGCAGCCGAGGCAGTCGCAGGACTTGGGGGTGAAGGAGCAGAAGCCGAAGGGGCGGTTGGGGATGTTGCAGTTGATGGCGTAGCAGCACGGGGAGAGGATGCATCCGCCGCCCCTGGATCCTCCGCCTCCGCCTCCGCCGCCGCAGCAGGTGCATGGCGCGCAGAGCTGGAAGCTCCCCAGCCTCCGCCGCGTCTCGTTGAGCACCATCGCGCTGAACCCCCCGCCCCCCTCCACCACCGGCACCATCCGCGCCACCTCCACCTCCTCCCCCGCGCCGCCGACCTGTGAGGTGGCGCTGCAATTGGAGGCGGCGAGGAGGAAGAGGAGGAGGAAGAGGAAGGTGGACGGCGGCGCGGTGGGGGTGAGCATTGCTGGCTGGCTGCTGATGCCCGCGTCGCTCCCTCTGCTTGCTAGGGTTTGGGAGGAGGGTGGGATGGATTGCGATGGAGTTGAGGTGGGAGATTTGGAGGAGGAGGATCGAGAGAGGGAAACGGGGAAACGGTGGAGTGGAGTGGAGTGAAGTGAGAGAGAGAGTGTCTTTC
| Transcript ID | Chromosome | Locus | Ref | Alt |
|---|---|---|---|---|
| Osa01LNT0052600.1 | 1 | 39996623 | G | A |
| Osa01LNT0052600.1 | 1 | 39991256 | T | C |
| Osa01LNT0052600.1 | 1 | 39991517 | C | A |
| Osa01LNT0052600.1 | 1 | 39991644 | A | C |
| Osa01LNT0052600.1 | 1 | 39992909 | C | A |
| Osa01LNT0052600.1 | 1 | 39993246 | T | A |
| Osa01LNT0052600.1 | 1 | 39993855 | T | C |
| Osa01LNT0052600.1 | 1 | 39995685 | G | T |
| Osa01LNT0052600.1 | 1 | 39996018 | A | C |
| Osa01LNT0052600.1 | 1 | 39996218 | A | G |
| Osa01LNT0052600.1 | 1 | 39996418 | G | A |
| Osa01LNT0052600.1 | 1 | 39998824 | A | G |
| Osa01LNT0052600.1 | 1 | 39991411 | T | A |
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa01LNT0052600.1 | osa-miR390-3p | Cleavage | 5.0 | 10.547 | 1 | 20 |
| Osa01LNT0052600.1 | osa-miR528-5p | Translation | 4.5 | 22.162 | 1 | 21 |
| Osa01LNT0052600.1 | osa-miR1861c | Translation | 3.5 | 16.008 | 1 | 22 |
| Osa01LNT0052600.1 | osa-miR1861e | Translation | 4.5 | 16.008 | 1 | 22 |
| Osa01LNT0052600.1 | osa-miR1861k | Translation | 4.5 | 16.008 | 1 | 22 |
| Osa01LNT0052600.1 | osa-miR1861m | Translation | 4.5 | 16.008 | 1 | 22 |
| Osa01LNT0052600.1 | osa-miR2118a | Translation | 5.0 | 8.746 | 1 | 22 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | C86 | RZ14 |
| Osa01LNT0052600.1 | 1 | yd1b | Morphological trait | Seed | C547 | C2340 |
| Osa01LNT0052600.1 | 1 | qPH1-1 | Morphological trait | Shoot/Seedling | C86 | RG236 |
| Osa01LNT0052600.1 | 1 | pl1.1 | Morphological trait | Panicle/flower | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | qPHT1-1 | Morphological trait | Dwarf | RZ730 | RG810 |
| Osa01LNT0052600.1 | 1 | sd-1 | Morphological trait | Dwarf | RZ730 | RG810 |
| Osa01LNT0052600.1 | 1 | qRIE 1 | Resistance or Tolerance | Submergency tolerance | C86 | G54 |
| Osa01LNT0052600.1 | 1 | brt1d | Resistance or Tolerance | Drought tolerance | C742 | C904 |
| Osa01LNT0052600.1 | 1 | FSM | Morphological trait | Shoot/Seedling | nan | nan |
| Osa01LNT0052600.1 | 1 | rrw1b | Resistance or Tolerance | Other soil stress tolerance | C86 | RG236 |
| Osa01LNT0052600.1 | 1 | nan | Physiological trait | Eating quality | RM8084 | RM6827 |
| Osa01LNT0052600.1 | 1 | dth1.1 | Physiological trait | Flowering | RG541 | RG109 |
| Osa01LNT0052600.1 | 1 | qRNd1 | Resistance or Tolerance | Other soil stress tolerance | RG236 | C86 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | nan | Morphological trait | Seed | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | tn1-4 | Morphological trait | Culm/leaf | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | fll1 | Morphological trait | Culm/leaf | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | ph1 | Morphological trait | Dwarf | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | sd1 | Resistance or Tolerance | Drought tolerance | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | qPHT-1 | Morphological trait | Dwarf | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | Fh1-2 | Morphological trait | Dwarf | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RZ730 | RG810 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RG690 | RG810 |
| Osa01LNT0052600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RG810 | RZ730 |
| Osa01LNT0052600.1 | 1 | nan | Morphological trait | Root | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | qNOP-1 | Morphological trait | Culm/leaf | RZ730 | RZ801 |
| Osa01LNT0052600.1 | 1 | qPL-1 | Morphological trait | Panicle/flower | RZ730 | RZ801 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)