© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa01LNT0454200.1
AATGTTATATAGAAAAATAACCAAAATAAAAGTTATAGATCTTGATGAGTTATACAACTTTGTTGTTGATGACTTTTTCAATTGAAGTCGTTCACTGATCTAAAATTCTATTTGAACTTTTCAAACTTTGAATTTTAAATTTCAAATTATTTAAATAGAGTCATATGGAGAAATAACCAAAATAAAAATTTTACACCTCGATGAGTTCTGCAACTTTGGTTTTGGTGACTTTTCCATTTGAAATC
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa01LNT0454200.1 | osa-miR437 | Cleavage | 4.0 | 14.719 | 1 | 21 |
| Osa01LNT0454200.1 | osa-miR821a | Cleavage | 1.0 | 18.581 | 1 | 24 |
| Osa01LNT0454200.1 | osa-miR821a | Translation | 3.5 | 19.326 | 1 | 24 |
| Osa01LNT0454200.1 | osa-miR821b | Cleavage | 1.0 | 18.581 | 1 | 24 |
| Osa01LNT0454200.1 | osa-miR821b | Translation | 3.5 | 19.326 | 1 | 24 |
| Osa01LNT0454200.1 | osa-miR821c | Cleavage | 1.0 | 18.581 | 1 | 24 |
| Osa01LNT0454200.1 | osa-miR821c | Translation | 3.5 | 19.326 | 1 | 24 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa01LNT0454200.1 | 1 | yd1a | Morphological trait | Seed | R753 | C161 |
| Osa01LNT0454200.1 | 1 | nan | Physiological trait | Eating quality | C161 | R753 |
| Osa01LNT0454200.1 | 1 | nan | Physiological trait | Eating quality | C161 | R753 |
| Osa01LNT0454200.1 | 1 | nan | Physiological trait | Source activity | RG532 | RG472 |
| Osa01LNT0454200.1 | 1 | n+p1a | Resistance or Tolerance | Other soil stress tolerance | C161 | R753 |
| Osa01LNT0454200.1 | 1 | n+s1a | Resistance or Tolerance | Other soil stress tolerance | C161 | R753 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)