© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa09LNT0581800.1
CCAAAAAAAAAAGGCAAACCCTGGGTTTGCGTGTCCAACTTTGACTGTCCGTCTTATATGAATTTTTTTTAAAATTTGTATTTTCATTGTTGTTAGATGATAAAACATGATTAATATTTTATGCGTGACTTGTCTTTTTAATTTTTTTCATAATTTTTTCAAATAAGACGGACGGTCAAACGTTGGGCACGGAAACCAGGGTTTGTCTTTTTTGGATGG
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa09LNT0581800.1 | osa-miR812p | Translation | 2.0 | 16.997 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR812s | Translation | 3.0 | 14.787 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR5799 | Translation | 5.0 | 14.787 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR812a | Cleavage | 3.0 | 16.997 | 1 | 22 |
| Osa09LNT0581800.1 | osa-miR812b | Cleavage | 3.0 | 16.997 | 1 | 22 |
| Osa09LNT0581800.1 | osa-miR812c | Cleavage | 3.0 | 16.997 | 1 | 22 |
| Osa09LNT0581800.1 | osa-miR812d | Cleavage | 3.0 | 16.997 | 1 | 22 |
| Osa09LNT0581800.1 | osa-miR812e | Cleavage | 3.0 | 16.997 | 1 | 22 |
| Osa09LNT0581800.1 | osa-miR812f | Cleavage | 2.5 | 18.771 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR812g | Translation | 2.5 | 14.787 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR812h | Translation | 2.5 | 14.787 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR812i | Translation | 2.5 | 14.787 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR812j | Translation | 2.5 | 14.787 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR812k | Cleavage | 2.5 | 18.771 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR812l | Cleavage | 2.5 | 18.771 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR812m | Cleavage | 2.5 | 18.771 | 1 | 24 |
| Osa09LNT0581800.1 | osa-miR812o-5p | Cleavage | 1.5 | 18.387 | 1 | 21 |
| Osa09LNT0581800.1 | osa-miR812o-3p | Cleavage | 5.0 | 18.933 | 1 | 24 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa09LNT0581800.1 | 9 | clr9 | Resistance or Tolerance | Cold tolerance | RM285 | RM434 |
| Osa09LNT0581800.1 | 9 | qAC9 | Physiological trait | Eating quality | RM4413 | RM5122 |
| Osa09LNT0581800.1 | 9 | qLG-9 | Physiological trait | Germination/dormancy | G103 | R1751 |
| Osa09LNT0581800.1 | 9 | rdw9 | Resistance or Tolerance | Drought tolerance | R79 | R2638 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)