© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa08LNT0556300.1
TACTTCCGTCCCAAAATAAGTGCAGCCATGGGAATCCGTATCCAACGTTTGACCGTCCGTTTTATTTGAAAAATTTATGAAAAAATTAGTCACACAAAGTACTATTCATGTTTTATCATCTAATAACAATAAAAGTACTAATCATAAAAACATTTTAAATAAGATGAACGGTCAAACGTTAGATATAAATATTGTAAAACTGCACTTATTTTGTGACGGAGGTA
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa08LNT0556300.1 | osa-miR812p | Translation | 4.0 | 12.399 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812q | Cleavage | 3.5 | 10.272 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812r | Translation | 4.5 | 10.272 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812s | Translation | 2.5 | 12.725 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR5799 | Translation | 4.5 | 12.725 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812t | Cleavage | 4.5 | 10.414 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812u | Cleavage | 4.5 | 10.414 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812v | Cleavage | 3.0 | 10.41 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812a | Cleavage | 1.0 | 12.399 | 1 | 22 |
| Osa08LNT0556300.1 | osa-miR812b | Cleavage | 1.0 | 12.399 | 1 | 22 |
| Osa08LNT0556300.1 | osa-miR812c | Cleavage | 1.0 | 12.399 | 1 | 22 |
| Osa08LNT0556300.1 | osa-miR812d | Cleavage | 1.0 | 12.399 | 1 | 22 |
| Osa08LNT0556300.1 | osa-miR812e | Cleavage | 1.0 | 12.399 | 1 | 22 |
| Osa08LNT0556300.1 | osa-miR812f | Cleavage | 4.0 | 12.394 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812g | Translation | 4.5 | 12.725 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812h | Translation | 4.5 | 12.725 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812i | Translation | 4.5 | 12.725 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812j | Translation | 4.5 | 12.725 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812k | Cleavage | 4.0 | 12.394 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812l | Cleavage | 4.0 | 12.394 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812m | Cleavage | 4.0 | 12.394 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812n-3p | Cleavage | 4.5 | 10.414 | 1 | 24 |
| Osa08LNT0556300.1 | osa-miR812o-5p | Cleavage | 4.5 | 12.327 | 1 | 21 |
| Osa08LNT0556300.1 | osa-miR812o-3p | Cleavage | 4.0 | 14.477 | 1 | 24 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa08LNT0556300.1 | 8 | dth8 | Physiological trait | Flowering | RG333 | RZ66 |
| Osa08LNT0556300.1 | 8 | nan | Physiological trait | Source activity | R727 | R202 |
| Osa08LNT0556300.1 | 8 | qPN-8 | Morphological trait | Seed | RM223 | RM80 |
| Osa08LNT0556300.1 | 8 | aro8-1 | Physiological trait | Eating quality | RM223 | RM80 |
| Osa08LNT0556300.1 | 8 | Aroma | Physiological trait | Eating quality | RG28 | RG1 |
| Osa08LNT0556300.1 | 8 | nan | Resistance or Tolerance | Drought tolerance | RG978 | RZ66 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|---|---|---|---|---|---|---|
| Osa08LNT0556300.1 | osa-MIR812b | 84.177 | 158 | 3 | 158 | 4.59e-34 | 141 |
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)