© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa01LNT0008700.1
AATATAAGAGATTTTGAGTTTTTGCTTGCAACGTTTGACCACTCGGCTTATTCAAAAATTTTTGAAATTATTATTTATTTTATTTGTGACTTACTTTATTATTCACAGTACTTTAAGTACAACTTTTCGTTTTTTATATTTGCAAAAAAAATTGTATAAGACGAGTGGTCAAACGTTGTACGCAAAAACTCAAAATCCCTTATATT
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa01LNT0008700.1 | osa-miR812o-5p | Cleavage | 4.0 | 15.674 | 1 | 21 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa01LNT0008700.1 | 1 | Rf3 | Physiological trait | Sterility | nan | nan |
| Osa01LNT0008700.1 | 1 | Rf | Physiological trait | Sterility | nan | nan |
| Osa01LNT0008700.1 | 1 | ppp1.1 | Morphological trait | Panicle/flower | RG140 | RM243 |
| Osa01LNT0008700.1 | 1 | prg1.2 | Physiological trait | Source activity | RG140 | RM243 |
| Osa01LNT0008700.1 | 1 | spp1.2 | Morphological trait | Panicle/flower | RG140 | RM243 |
| Osa01LNT0008700.1 | 1 | nan | Resistance or Tolerance | Salinity tolerance | RM1 | R886 |
| Osa01LNT0008700.1 | 1 | nan | Resistance or Tolerance | Salinity tolerance | RM1 | R886 |
| Osa01LNT0008700.1 | 1 | gp1 | Morphological trait | Panicle/flower | RG532 | RM259 |
| Osa01LNT0008700.1 | 1 | nan | Resistance or Tolerance | Salinity tolerance | RM1 | RM5 |
| Osa01LNT0008700.1 | 1 | nan | Physiological trait | Source activity | RG532 | RM472 |
| Osa01LNT0008700.1 | 1 | An9 | Morphological trait | Panicle/flower | nan | nan |
| Osa01LNT0008700.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | C955 | C885 |
| Osa01LNT0008700.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | C955 | C885 |
| Osa01LNT0008700.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | C955 | C885 |
| Osa01LNT0008700.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | C955 | C885 |
| Osa01LNT0008700.1 | 1 | nan | Resistance or Tolerance | Lodging resistance | R1944 | C955 |
| Osa01LNT0008700.1 | 1 | nan | Morphological trait | Root | RM7383 | RM243 |
| Osa01LNT0008700.1 | 1 | nan | Morphological trait | Root | RM7383 | RM23 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)