© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa03LNT0225600.1
AATATTTGACACCGTTGACTTTTTTAAACATGTTTGACCATTCGTCTTATTCAAAAACTTTTATGAAATGTGTAAAACTATATGAATACATGAAAGTATATTTAACAATAAATCAAATGATACGAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGACGAACGGTCAAACATTCTTAAAAAAGTCAACGGCGTCAAACATT
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa03LNT0225600.1 | osa-miR5799 | Translation | 2.5 | 10.355 | 1 | 24 |
| Osa03LNT0225600.1 | osa-miR812a | Cleavage | 5.0 | 9.628 | 1 | 22 |
| Osa03LNT0225600.1 | osa-miR812b | Cleavage | 5.0 | 9.628 | 1 | 22 |
| Osa03LNT0225600.1 | osa-miR812c | Cleavage | 5.0 | 9.628 | 1 | 22 |
| Osa03LNT0225600.1 | osa-miR812d | Cleavage | 5.0 | 9.628 | 1 | 22 |
| Osa03LNT0225600.1 | osa-miR812e | Cleavage | 5.0 | 9.628 | 1 | 22 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa03LNT0225600.1 | 3 | gw3a | Morphological trait | Seed | R19 | RZ403 |
| Osa03LNT0225600.1 | 3 | nan | Morphological trait | Panicle/flower | RZ448 | RZ403 |
| Osa03LNT0225600.1 | 3 | nan | Physiological trait | Eating quality | RZ403 | R19 |
| Osa03LNT0225600.1 | 3 | An5(t) | Morphological trait | Panicle/flower | C1677 | R19 |
| Osa03LNT0225600.1 | 3 | nan | Resistance or Tolerance | Blast resistance | RM16 | RM168 |
| Osa03LNT0225600.1 | 3 | gw3.1 | Morphological trait | Seed | RZ672 | RZ474 |
| Osa03LNT0225600.1 | 3 | nan | Resistance or Tolerance | Insect resistance | G332 | R19 |
| Osa03LNT0225600.1 | 3 | qGL-3 | Morphological trait | Seed | R19 | C1677 |
| Osa03LNT0225600.1 | 3 | qLWR-3 | Morphological trait | Seed | R19 | C1677 |
| Osa03LNT0225600.1 | 3 | n-p3 | Resistance or Tolerance | Other soil stress tolerance | RZ403 | R19 |
| Osa03LNT0225600.1 | 3 | qSV-3-1 | Morphological trait | Shoot/Seedling | RM156 | RM168 |
| Osa03LNT0225600.1 | 3 | qSV-3-1 | Morphological trait | Shoot/Seedling | RM156 | RM168 |
| Osa03LNT0225600.1 | 3 | Yd3-13 | Morphological trait | Seed | RZ403 | CDO337 |
| Osa03LNT0225600.1 | 3 | nan | Morphological trait | Shoot/Seedling | RZ403 | RZ630 |
| Osa03LNT0225600.1 | 3 | nan | Morphological trait | Shoot/Seedling | RZ452 | RZ448 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)