© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa01LNT0459500.1
TACCACCTCCATATTTTAATATATGACGCCGTTAACTTTTTGTCCAATGTTTGACCATTCGTTTTATTCAAAAAATTTATATAATTATTATTTATTTTATTATGACTTGATGACGTCAAATTGTTCTTTAAGCATGACATAAATATTTTCATATTTACACCAAAAATTTGAATAAAACGAATGATCAAACGTTGGTTGAAAAGTCAACGGCGTCATATATTAAAATACGGAGGGAGTA
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa01LNT0459500.1 | osa-miR812s | Translation | 4.5 | 5.785 | 1 | 24 |
| Osa01LNT0459500.1 | osa-miR5799 | Translation | 3.0 | 5.785 | 1 | 24 |
| Osa01LNT0459500.1 | osa-miR6248 | Translation | 4.5 | 6.576 | 1 | 21 |
| Osa01LNT0459500.1 | osa-miR812a | Cleavage | 3.5 | 5.814 | 1 | 22 |
| Osa01LNT0459500.1 | osa-miR812b | Cleavage | 3.5 | 5.814 | 1 | 22 |
| Osa01LNT0459500.1 | osa-miR812c | Cleavage | 3.5 | 5.814 | 1 | 22 |
| Osa01LNT0459500.1 | osa-miR812d | Cleavage | 3.5 | 5.814 | 1 | 22 |
| Osa01LNT0459500.1 | osa-miR812e | Cleavage | 3.5 | 5.814 | 1 | 22 |
| Osa01LNT0459500.1 | osa-miR812g | Translation | 5.0 | 5.785 | 1 | 24 |
| Osa01LNT0459500.1 | osa-miR812h | Translation | 5.0 | 5.785 | 1 | 24 |
| Osa01LNT0459500.1 | osa-miR812i | Translation | 5.0 | 5.785 | 1 | 24 |
| Osa01LNT0459500.1 | osa-miR812j | Translation | 5.0 | 5.785 | 1 | 24 |
| Osa01LNT0459500.1 | osa-miR812k | Cleavage | 4.5 | 6.132 | 1 | 24 |
| Osa01LNT0459500.1 | osa-miR812l | Cleavage | 4.5 | 6.132 | 1 | 24 |
| Osa01LNT0459500.1 | osa-miR812m | Cleavage | 4.5 | 6.132 | 1 | 24 |
| Osa01LNT0459500.1 | osa-miR812o-3p | Cleavage | 3.5 | 9.238 | 1 | 24 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa01LNT0459500.1 | 1 | nan | Morphological trait | Panicle/flower | CDO920 | RZ776 |
| Osa01LNT0459500.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | BCD134 | RZ776 |
| Osa01LNT0459500.1 | 1 | nan | Physiological trait | Source activity | RG532 | RM472 |
| Osa01LNT0459500.1 | 1 | qVB-1 | Morphological trait | Culm/leaf | RZ776 | RZ744 |
| Osa01LNT0459500.1 | 1 | qVB-1 | Morphological trait | Culm/leaf | RZ776 | RZ744 |
| Osa01LNT0459500.1 | 1 | brt1d | Resistance or Tolerance | Drought tolerance | C742 | C904 |
| Osa01LNT0459500.1 | 1 | rfw1b | Resistance or Tolerance | Drought tolerance | C813 | C955 |
| Osa01LNT0459500.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RM129 | RM5 |
| Osa01LNT0459500.1 | 1 | nan | Morphological trait | Root | RM23 | RM306 |
| Osa01LNT0459500.1 | 1 | nan | Resistance or Tolerance | Salinity tolerance | RM1 | R886 |
| Osa01LNT0459500.1 | 1 | nan | Resistance or Tolerance | Salinity tolerance | RM1 | R886 |
| Osa01LNT0459500.1 | 1 | nan | Resistance or Tolerance | Salinity tolerance | RM1 | RM5 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)