© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa06LNT0510200.1
TACAACCTCCAAATTTAAATATATGACGCCGTTGACTTTTTGTTCAACGTTTGACCATTCGTCTTATTCAAAAAATTTATGTAATTATCATTTATTTTATTGTGGATTGATTCGTCATCAAATATTCTTTAAGCATGACATAAATATTTTGATATTTGCACAAAAATTTGAATAAAACGAATGGTCAAACGTTGGTCGAAAAGTCAACGGCGTCATACATTAAAATACGGATGGAGTA
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa06LNT0510200.1 | osa-miR812s | Translation | 3.5 | 12.166 | 1 | 24 |
| Osa06LNT0510200.1 | osa-miR5799 | Translation | 2.0 | 12.166 | 1 | 24 |
| Osa06LNT0510200.1 | osa-miR6248 | Translation | 4.0 | 8.934 | 1 | 21 |
| Osa06LNT0510200.1 | osa-miR443 | Translation | 4.5 | 16.788 | 1 | 22 |
| Osa06LNT0510200.1 | osa-miR812a | Cleavage | 2.5 | 12.194 | 1 | 22 |
| Osa06LNT0510200.1 | osa-miR812b | Cleavage | 2.5 | 12.194 | 1 | 22 |
| Osa06LNT0510200.1 | osa-miR812c | Cleavage | 2.5 | 12.194 | 1 | 22 |
| Osa06LNT0510200.1 | osa-miR812d | Cleavage | 2.5 | 12.194 | 1 | 22 |
| Osa06LNT0510200.1 | osa-miR812e | Cleavage | 2.5 | 12.194 | 1 | 22 |
| Osa06LNT0510200.1 | osa-miR1428e-3p | Translation | 5.0 | 12.554 | 1 | 21 |
| Osa06LNT0510200.1 | osa-miR812g | Translation | 4.0 | 12.166 | 1 | 24 |
| Osa06LNT0510200.1 | osa-miR812h | Translation | 4.0 | 12.166 | 1 | 24 |
| Osa06LNT0510200.1 | osa-miR812i | Translation | 4.0 | 12.166 | 1 | 24 |
| Osa06LNT0510200.1 | osa-miR812j | Translation | 4.0 | 12.166 | 1 | 24 |
| Osa06LNT0510200.1 | osa-miR812k | Cleavage | 4.5 | 12.807 | 1 | 24 |
| Osa06LNT0510200.1 | osa-miR812l | Cleavage | 4.5 | 12.807 | 1 | 24 |
| Osa06LNT0510200.1 | osa-miR812m | Cleavage | 4.5 | 12.807 | 1 | 24 |
| Osa06LNT0510200.1 | osa-miR812o-3p | Cleavage | 3.5 | 14.78 | 1 | 24 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa06LNT0510200.1 | 6 | qLDLJ-6-1,2,3 | Physiological trait | Source activity | RM217 | RM3 |
| Osa06LNT0510200.1 | 6 | gw6 | Morphological trait | Panicle/flower | RG424 | R2549 |
| Osa06LNT0510200.1 | 6 | RPLD4 | Physiological trait | Eating quality | RG424 | RG172 |
| Osa06LNT0510200.1 | 6 | nan | Physiological trait | Eating quality | RM253 | RM162 |
| Osa06LNT0510200.1 | 6 | amy6-1 | Physiological trait | Eating quality | RM3 | RM217 |
| Osa06LNT0510200.1 | 6 | asv6-1 | Physiological trait | Eating quality | RM3 | RM217 |
| Osa06LNT0510200.1 | 6 | tgw6.1 | Physiological trait | Source activity | RG264 | RM3 |
| Osa06LNT0510200.1 | 6 | ph6 | Morphological trait | Dwarf | RZ667 | RG653 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)