© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa03LNT0224100.1
GATATCAGCTGAAAAAGTCATCAACAAAAAAGTTGAATAACTCATCAAGATCTAAAACTTTTATTTTGGTCATTTCTTCATACGACAAAGTGATAGTAACATTGTTCACAGAATTGACATATCTCTTATCTGGTTTTATAAACTATAACACATATATGTAAAATTTGTGAATAATATTACTAACATTTCGTCAGATGAAGAAATAAAAAAATAAAAGTTATAGATCTTGATGAGTTATTCAACTTTGTTGTTGATGACTTTTTCAATTGAAATC
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa03LNT0224100.1 | osa-miR821a | Cleavage | 1.0 | 14.136 | 1 | 24 |
| Osa03LNT0224100.1 | osa-miR821a | Translation | 4.5 | 7.582 | 1 | 24 |
| Osa03LNT0224100.1 | osa-miR821b | Cleavage | 1.0 | 14.136 | 1 | 24 |
| Osa03LNT0224100.1 | osa-miR821b | Translation | 4.5 | 7.582 | 1 | 24 |
| Osa03LNT0224100.1 | osa-miR821c | Cleavage | 1.0 | 14.136 | 1 | 24 |
| Osa03LNT0224100.1 | osa-miR821c | Translation | 4.5 | 7.582 | 1 | 24 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa03LNT0224100.1 | 3 | nan | Morphological trait | Shoot/Seedling | RZ284 | RZ403 |
| Osa03LNT0224100.1 | 3 | nan | Morphological trait | Shoot/Seedling | RZ452 | RZ448 |
| Osa03LNT0224100.1 | 3 | nan | Morphological trait | Panicle/flower | RZ403 | RZ452 |
| Osa03LNT0224100.1 | 3 | An5(t) | Morphological trait | Panicle/flower | C1677 | R19 |
| Osa03LNT0224100.1 | 3 | gw3.1 | Morphological trait | Seed | RZ672 | RZ474 |
| Osa03LNT0224100.1 | 3 | nan | Resistance or Tolerance | Insect resistance | G332 | R19 |
| Osa03LNT0224100.1 | 3 | qGL-3 | Morphological trait | Seed | R19 | C1677 |
| Osa03LNT0224100.1 | 3 | qLWR-3 | Morphological trait | Seed | R19 | C1677 |
| Osa03LNT0224100.1 | 3 | qSV-3-1 | Morphological trait | Shoot/Seedling | RM156 | RM168 |
| Osa03LNT0224100.1 | 3 | qSV-3-1 | Morphological trait | Shoot/Seedling | RM156 | RM168 |
| Osa03LNT0224100.1 | 3 | ccf3b | Physiological trait | Source activity | RM16 | RM282 |
| Osa03LNT0224100.1 | 3 | ccfs3 | Physiological trait | Source activity | RM16 | RM282 |
| Osa03LNT0224100.1 | 3 | nan | Resistance or Tolerance | Other stress resistance | RM4512 | RM8208 |
| Osa03LNT0224100.1 | 3 | nan | Resistance or Tolerance | Other stress resistance | RM4512 | RM8208 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|---|---|---|---|---|---|---|
| Osa03LNT0224100.1 | osa-MIR821a | 100.0 | 274 | 1 | 274 | 6.69e-144 | 507 |
| Osa03LNT0224100.1 | osa-MIR821b | 93.818 | 275 | 7 | 281 | 1.58e-115 | 412 |
| Osa03LNT0224100.1 | osa-MIR821c | 95.506 | 267 | 1 | 266 | 1.87e-119 | 425 |
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)