© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa08LNT0556100.1
GTGAGTCAGCATGGGACCCATGTGGGCCCCACATGTCAGGACGCCACGTCATCAGGGTCTCTCTTTCCCCTACTCTCCCTTCCTCCTCTCTCTCTCTCACACACTCATCTCCCTGGGCAGGCCAGCCGCCGGCGATGCGGCAGTGGTGACGCGGCGGCGGCGACACGGGAGAAGAGGAGGGAGGTGGCAGCGGGAGCACGGGGGAGATCAAAGACAACGAGCTCGAGCACTACGGCA
| Transcript ID | Transposon ID | Chromosome | Strand | Start | End | Counts |
|---|---|---|---|---|---|---|
| Osa08LNT0556100.1 | DTM_#DNAt_MULE_japo_Os0037 | Chr8 | - | 20399503 | 20400894 | 236 |
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa08LNT0556100.1 | osa-miR7692-3p | Translation | 5.0 | 23.321 | 1 | 24 |
| Osa08LNT0556100.1 | osa-miR2919 | Translation | 3.5 | 10.493 | 1 | 19 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa08LNT0556100.1 | 8 | qMRLw8 | Resistance or Tolerance | Other soil stress tolerance | RM223 | R727 |
| Osa08LNT0556100.1 | 8 | nan | Resistance or Tolerance | Drought tolerance | RG978 | RZ66 |
| Osa08LNT0556100.1 | 8 | Aroma | Physiological trait | Eating quality | RG28 | RG1 |
| Osa08LNT0556100.1 | 8 | dth8 | Physiological trait | Flowering | RG333 | RZ66 |
| Osa08LNT0556100.1 | 8 | nan | Physiological trait | Source activity | R727 | R202 |
| Osa08LNT0556100.1 | 8 | QalRr8.1 | Resistance or Tolerance | Other stress resistance | RG28 | RM223 |
| Osa08LNT0556100.1 | 8 | QalSr8.1 | Resistance or Tolerance | Other stress resistance | RG28 | RM223 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)