© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa04LNT0282400.1
GCTTGCCGACGCGTGGAGGGACATCAGGAACACCATTGCTGAGAACCTGTACCTCCGGTTGGCCGATTCTACTGGTATGCCCACCCTTTTTCCCCTGTTTTTGAACACGACCACCAGGTTACTATCTCCCACAAGCTTGCAAGCTACTGTATGTTTGACGCTGTAACTTCTGTTCACCCACATTCTTCACAGGGTCAAATTCTTGTCATTCTGTCAATGATATGAGGAATAGCGATGTCATTT
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa04LNT0282400.1 | osa-miR395b | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395d | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395e | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395g | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395h | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395i | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395j | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395k | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395l | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395s | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395m | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395n | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395p | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395q | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR395r | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR2118d | Translation | 4.0 | 16.707 | 1 | 22 |
| Osa04LNT0282400.1 | osa-miR395y | Translation | 4.0 | 14.644 | 1 | 21 |
| Osa04LNT0282400.1 | osa-miR5496 | Translation | 5.0 | 17.446 | 1 | 21 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa04LNT0282400.1 | 4 | nan | Morphological trait | Root | RG476 | RG214 |
| Osa04LNT0282400.1 | 4 | nan | Morphological trait | Root | RG476 | RG214 |
| Osa04LNT0282400.1 | 4 | OsAOX1a | Resistance or Tolerance | Cold tolerance | R2737 | R740 |
| Osa04LNT0282400.1 | 4 | pss4.1 | Physiological trait | Source activity | RZ740 | RZ590 |
| Osa04LNT0282400.1 | 4 | phc4.1 | Resistance or Tolerance | Drought tolerance | RG476 | RG214 |
| Osa04LNT0282400.1 | 4 | phs4.1 | Resistance or Tolerance | Drought tolerance | RG476 | RG214 |
| Osa04LNT0282400.1 | 4 | nan | Morphological trait | Panicle/flower | RM303 | RM348 |
| Osa04LNT0282400.1 | 4 | qSN-4b | Resistance or Tolerance | Drought tolerance | RM255 | RM349 |
| Osa04LNT0282400.1 | 4 | Xa2 | Resistance or Tolerance | Bacterial blight resistance | RM317 | RM349 |
| Osa04LNT0282400.1 | 4 | nan | Morphological trait | Root | RM3276 | RM3335 |
| Osa04LNT0282400.1 | 4 | rfw4a | Resistance or Tolerance | Drought tolerance | RM349 | RM1136 |
| Osa04LNT0282400.1 | 4 | nan | Physiological trait | Source activity | RG143 | RG329 |
| Osa04LNT0282400.1 | 4 | gpp4 | Morphological trait | Seed | RZ569 | RZ565 |
| Osa04LNT0282400.1 | 4 | qSHT-4 | Morphological trait | Panicle/flower | CDO244 | RG214 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)