© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa06LNT0325500.1
CAAGGCTGACCAACTATGACTCGATGAGACGGCATATAGTGGTTGCAGCATCTGCTCTGAGAAATTATAATACATTCCAATAGCAGCATGTGCTCTTCTTCCCCCTTTCAAAGCAAGCAAATCCCATAAATTGATAAATACGACAACCCCCTTGCTGTCCCCTCCACATCGGAATCTCTCACCCAACTCAAGAGCAACCGCAGCCATGGCCGACAACAACTTCGGAGAGCTTCCGGTGGACGGTGAGCCCGG
| Transcript ID | Chromosome | Locus | Ref | Alt |
|---|---|---|---|---|
| Osa06LNT0325500.1 | 6 | 1385882 | G | A |
| Osa06LNT0325500.1 | 6 | 1385993 | G | A |
| Osa06LNT0325500.1 | 6 | 1386032 | T | C |
| Osa06LNT0325500.1 | 6 | 1386587 | A | G |
| Osa06LNT0325500.1 | 6 | 1386809 | A | G |
| Osa06LNT0325500.1 | 6 | 1386923 | A | G |
| Osa06LNT0325500.1 | 6 | 1386947 | T | A |
| Osa06LNT0325500.1 | 6 | 1386949 | A | T |
| Osa06LNT0325500.1 | 6 | 1386988 | A | G |
| Osa06LNT0325500.1 | 6 | 1387461 | A | G |
| Osa06LNT0325500.1 | 6 | 1387544 | T | A |
| Osa06LNT0325500.1 | 6 | 1387559 | A | C |
| Osa06LNT0325500.1 | 6 | 1387842 | T | C |
| Osa06LNT0325500.1 | 6 | 1387968 | T | G |
| Osa06LNT0325500.1 | 6 | 1388018 | C | T |
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa06LNT0325500.1 | osa-miR164a | Translation | 4.5 | 10.145 | 1 | 21 |
| Osa06LNT0325500.1 | osa-miR164b | Translation | 4.5 | 10.145 | 1 | 21 |
| Osa06LNT0325500.1 | osa-miR164c | Translation | 5.0 | 10.145 | 1 | 21 |
| Osa06LNT0325500.1 | osa-miR164d | Translation | 4.5 | 10.145 | 1 | 21 |
| Osa06LNT0325500.1 | osa-miR164e | Translation | 4.5 | 10.145 | 1 | 21 |
| Osa06LNT0325500.1 | osa-miR164f | Translation | 4.5 | 10.145 | 1 | 21 |
| Osa06LNT0325500.1 | osa-miR1854-3p | Translation | 5.0 | 6.814 | 1 | 22 |
| Osa06LNT0325500.1 | osa-miR2928 | Translation | 4.0 | 9.889 | 1 | 20 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa06LNT0325500.1 | 6 | qCRE-6 | Physiological trait | Eating quality | RM170 | RM190 |
| Osa06LNT0325500.1 | 6 | qVE-6 | Physiological trait | Eating quality | RM170 | RM190 |
| Osa06LNT0325500.1 | 6 | qWA-6 | Physiological trait | Eating quality | RM170 | RM190 |
| Osa06LNT0325500.1 | 6 | nan | Resistance or Tolerance | Drought tolerance | RM170 | RM204 |
| Osa06LNT0325500.1 | 6 | qHD6 | Physiological trait | Flowering | RM8120 | RM1369 |
| Osa06LNT0325500.1 | 6 | Hd3b | Physiological trait | Flowering | nan | nan |
| Osa06LNT0325500.1 | 6 | qAC-6 | Physiological trait | Eating quality | R2869 | R1962 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)