© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa08LNT0401100.1
GCACGGAGCATATTACTCTACATGATAACCGCACCCCGTGTACAAATTAAGCAGTTAACAATCCACAAAGACGCTCATACATGCAATTTACACATTGTCGTACAATGAATAGTGCAGATAGTTACATAGATAATATTGGGAAACAAATTTTAATCAGTGATATCTGCCCATATATTTTTTTTCTTTTAAATTCAATACAAATAATTATAAAAAATTTGAAAAAAATGAATAGTCCATCGTGTATTTTTTTCTCCCAAATTCAATACAAATAGTTATAAAAAATTTGAAAAAAAATGAATAGTGACATTTATAGTCCAAAAATTAAAGTTTAAATTCAACATACCCATTGAGA
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa08LNT0401100.1 | osa-miR5817 | Cleavage | 4.0 | 8.339 | 1 | 24 |
| Osa08LNT0401100.1 | osa-miR5817 | Translation | 3.5 | 7.731 | 1 | 24 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa08LNT0401100.1 | 8 | dth8 | Physiological trait | Flowering | RG333 | RZ66 |
| Osa08LNT0401100.1 | 8 | nan | Morphological trait | Panicle/flower | RG333 | RZ562 |
| Osa08LNT0401100.1 | 8 | nan | Physiological trait | Flowering | C166 | C1121 |
| Osa08LNT0401100.1 | 8 | nan | Resistance or Tolerance | Other soil stress tolerance | C390 | C1121 |
| Osa08LNT0401100.1 | 8 | qDSR 8 | Resistance or Tolerance | Other soil stress tolerance | RM3572 | RM404 |
| Osa08LNT0401100.1 | 8 | qRRE-8 | Resistance or Tolerance | Other soil stress tolerance | C166 | C1121 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)