© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa01LNT0044600.1
TGGTAAGTCTTTGATCTTTCTGCTTTTCAATAGGTTACAGGAAGAAAGGTGACATCTTTTCCAGGATTTGTCACTCAGACTGGCCATTGACCTTTCATTGACATCGAGATTCCAGTCCACACTAACATATGCTGTGCGCCGCTCGCCGCTCGCGGATTTCAGCGCGGGCTCGGCCGGCGGTGGCGCGGAGCGCCGTGCACTTCCGCCGCGGATTCGGCTCTACTCCTCTCCACTCCACTCCCCCACCTCCCGTCTCTGCCTCTCCCCTCGCGCCG
| Transcript ID | Chromosome | Locus | Ref | Alt |
|---|---|---|---|---|
| Osa01LNT0044600.1 | 1 | 34739201 | T | C |
| Osa01LNT0044600.1 | 1 | 34739259 | A | G |
| Osa01LNT0044600.1 | 1 | 34740333 | A | G |
| Osa01LNT0044600.1 | 1 | 34740946 | A | C |
| Osa01LNT0044600.1 | 1 | 34741184 | C | T |
| Osa01LNT0044600.1 | 1 | 34741220 | T | C |
| Osa01LNT0044600.1 | 1 | 34742467 | T | G |
| Osa01LNT0044600.1 | 1 | 34742687 | T | A |
| Osa01LNT0044600.1 | 1 | 34743197 | C | T |
| Osa01LNT0044600.1 | 1 | 34743546 | G | T |
| Osa01LNT0044600.1 | 1 | 34743757 | G | A |
| Osa01LNT0044600.1 | 1 | 34744814 | T | C |
| Osa01LNT0044600.1 | 1 | 34744964 | T | C |
| Osa01LNT0044600.1 | 1 | 34744979 | G | A |
| Osa01LNT0044600.1 | 1 | 34745194 | T | C |
| Osa01LNT0044600.1 | 1 | 34745321 | A | G |
| Osa01LNT0044600.1 | 1 | 34746033 | C | T |
| Osa01LNT0044600.1 | 1 | 34739301 | A | T |
| Osa01LNT0044600.1 | 1 | 34739632 | A | T |
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa01LNT0044600.1 | osa-miR172b | Cleavage | 4.5 | 12.312 | 1 | 21 |
| Osa01LNT0044600.1 | osa-miR1426 | Cleavage | 4.5 | 12.312 | 1 | 21 |
| Osa01LNT0044600.1 | osa-miR1850.1 | Translation | 4.5 | 17.239 | 1 | 21 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa01LNT0044600.1 | 1 | nan | Resistance or Tolerance | Insect resistance | RM543 | RM472 |
| Osa01LNT0044600.1 | 1 | dth1.1 | Physiological trait | Flowering | RG541 | RG109 |
| Osa01LNT0044600.1 | 1 | nan | Physiological trait | Source activity | RG532 | RM472 |
| Osa01LNT0044600.1 | 1 | ng1 | Morphological trait | Panicle/flower | RG374 | RG394 |
| Osa01LNT0044600.1 | 1 | sf1 | Physiological trait | Source activity | RG374 | RG394 |
| Osa01LNT0044600.1 | 1 | sf1 | Morphological trait | Seed | RG374 | RG394 |
| Osa01LNT0044600.1 | 1 | nan | Physiological trait | Source activity | RG374 | RG690 |
| Osa01LNT0044600.1 | 1 | ng1 | Morphological trait | Seed | RG374 | RG394 |
| Osa01LNT0044600.1 | 1 | nan | Morphological trait | Root | RM212 | R2417 |
| Osa01LNT0044600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RG690 | RG810 |
| Osa01LNT0044600.1 | 1 | An10 | Morphological trait | Panicle/flower | nan | nan |
| Osa01LNT0044600.1 | 1 | qLEJ-1 | Morphological trait | Shoot/Seedling | RM212 | RM297 |
| Osa01LNT0044600.1 | 1 | brt1d | Resistance or Tolerance | Drought tolerance | C742 | C904 |
| Osa01LNT0044600.1 | 1 | qLRC-1 | Resistance or Tolerance | Drought tolerance | RM237 | RM302 |
| Osa01LNT0044600.1 | 1 | rfw1b | Resistance or Tolerance | Drought tolerance | C813 | C955 |
| Osa01LNT0044600.1 | 1 | Pi35(t) | Resistance or Tolerance | Blast resistance | RM1216 | RM1003 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)