© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa01LNT0047300.1
CCTCAAGTGTGCTCTTGTTTCTTAGATCCTCTGACACCGGATAATGCCTGCAGCACCTCCATAGCACAACCATTTCTCGCTACCTTTATTCATGTTCCATCTCAACCGATGCAATGCTACAGCTTTAGGAGGAAAGACCTCAAAATTTTCAGGGGATTCACTACCCCTGCTGGTGCTTGTGTCAAAATTCTCTTGCATTGAAGGAGCAGCTAAAACTATGGCACCGGTTTCTTGTCCTTCATCAGGTTCATCTTGTTGACCATCTCTGATGCTCGGATTTATAGCACCATTGTATTCTGAGTTGGTAAGAAGTTTCCCTTCTTCTATAACATGCAATTGAGCTACATCTTTGCAAGTTTTAGTAGCCCGTTTGGTCCCCAGAGGAACATTTGACAAAGGAGAGTTTGGTAATGCGATACCAATTTTAATGGTTGTTCCCTCCTCTGATAATGAACCACAAAGAAAATATGGTACACGGTTCCTCCCAGGTTCCTTTTCCCAGAATCTCGGAGTAAGCTCAAAGCAAACAGCAGTTCCATCAGCCACACAATAAGCCGCATAGCCTGTAATTTCTGAGGCATGGACACTCCAGATCAAATATTCAGACAATTGATAGGTAGAAACACCCTGAGTTTTCGTTCCAACAAATGGCCTTCCAGTAAAAGGAACATCATTTGCGATTCTTGACAAGCTAACGAACTTTAATGTGCCATCTTCCAATGATATGACAACACCTCTTGCATCCTTCAACCATTGAAGACTTATTACGGCCCTTGGAGCAGTAGTTAACTCCCAAAGATGACGATATGGATCTCTTAAATCCCAGAATTTCAGACCATCCTCTCCAGCAGTGACAAAGGTATTCACGTTTTCCTCACAGATGGTGCCCACGACACGGTTCTGATGGGAGCAGATTCAGCAGTTACACACATAAAAGGTTTTGAACCTTGAAATGACAGGTTTGCAGAGAACTTCCATAAAGCAACCGTTCCATCGTGACATCCCGCCAATATCATATCATGAGAGGGTGACCAATCAACTTTGTCTGTTCCCGCACTTTACTTTGGCAGAGCTAAACACAGGCTTCAGCTTTAAAAATCGAGGGTCAGTACCCTCCTTTGAAGAAGAGGAATATATTTTCTGAATCATGCTTGGAGATGGAACTTCCC
| Transcript ID | Chromosome | Locus | Ref | Alt |
|---|---|---|---|---|
| Osa01LNT0047300.1 | 1 | 37080449 | C | T |
| Osa01LNT0047300.1 | 1 | 37081329 | C | G |
| Osa01LNT0047300.1 | 1 | 37082108 | G | A |
| Osa01LNT0047300.1 | 1 | 37083005 | A | T |
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa01LNT0047300.1 | osa-miR5530 | Cleavage | 4.5 | 14.392 | 1 | 21 |
| Osa01LNT0047300.1 | osa-miR166k-5p | Translation | 4.5 | 11.28 | 1 | 21 |
| Osa01LNT0047300.1 | osa-miR435 | Translation | 5.0 | 13.484 | 1 | 20 |
| Osa01LNT0047300.1 | osa-miR1852 | Cleavage | 5.0 | 16.978 | 1 | 21 |
| Osa01LNT0047300.1 | osa-miR1880 | Cleavage | 5.0 | 17.126 | 1 | 24 |
| Osa01LNT0047300.1 | osa-miR2092-5p | Cleavage | 4.0 | 17.7 | 1 | 21 |
| Osa01LNT0047300.1 | osa-miR2099-3p | Cleavage | 5.0 | 16.756 | 1 | 20 |
| Osa01LNT0047300.1 | osa-miR5496 | Translation | 5.0 | 18.345 | 1 | 21 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa01LNT0047300.1 | 1 | qSF-1 | Physiological trait | Source activity | RZ730 | RZ538 |
| Osa01LNT0047300.1 | 1 | yd1 | Morphological trait | Seed | C2340 | C86 |
| Osa01LNT0047300.1 | 1 | yd1b | Morphological trait | Seed | C547 | C2340 |
| Osa01LNT0047300.1 | 1 | qNSB1-1 | Morphological trait | Panicle/flower | C86 | C2340 |
| Osa01LNT0047300.1 | 1 | qSSBp1-1 | Morphological trait | Panicle/flower | C86 | C2340 |
| Osa01LNT0047300.1 | 1 | pl1.1 | Morphological trait | Panicle/flower | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | qChll1a | Morphological trait | Culm/leaf | C86 | C813 |
| Osa01LNT0047300.1 | 1 | qH2O21 | Others | Others | C86 | C813 |
| Osa01LNT0047300.1 | 1 | qPHT1-1 | Morphological trait | Dwarf | RZ730 | RG810 |
| Osa01LNT0047300.1 | 1 | sd-1 | Morphological trait | Dwarf | RZ730 | RG810 |
| Osa01LNT0047300.1 | 1 | qLVBTS1-1 | Morphological trait | Panicle/flower | C2340 | C86 |
| Osa01LNT0047300.1 | 1 | sf1.1 | Physiological trait | Sterility | RM212 | RM315 |
| Osa01LNT0047300.1 | 1 | brt1d | Resistance or Tolerance | Drought tolerance | C742 | C904 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Insect resistance | RM543 | RM472 |
| Osa01LNT0047300.1 | 1 | nan | Physiological trait | Eating quality | RM8084 | RM6827 |
| Osa01LNT0047300.1 | 1 | dth1.1 | Physiological trait | Flowering | RG541 | RG109 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | Fh1-2 | Morphological trait | Dwarf | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Morphological trait | Seed | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | fll1 | Morphological trait | Culm/leaf | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | ph1 | Morphological trait | Dwarf | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | sd1 | Resistance or Tolerance | Drought tolerance | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | tn1-4 | Morphological trait | Culm/leaf | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Morphological trait | Root | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | qNOP-1 | Morphological trait | Culm/leaf | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RZ730 | RG810 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RG690 | RG810 |
| Osa01LNT0047300.1 | 1 | nan | Physiological trait | Source activity | RG532 | RM472 |
| Osa01LNT0047300.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RG810 | RZ730 |
| Osa01LNT0047300.1 | 1 | qPHT-1 | Morphological trait | Dwarf | RZ730 | RZ801 |
| Osa01LNT0047300.1 | 1 | qPL-1 | Morphological trait | Panicle/flower | RZ730 | RZ801 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)