© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)
>Osa01LNT0053600.1
AACTATAAGCATACTACATTGCAGACCGAAGTTATAAGATCACAATGTGTTCCTAGTAACAACCACAACGCAAAATTTCAGGCTAGTTCTTTAGGTCATCCTCTGGGCAGCTTCCTTGGCTAGAAGCTTTTCCCTGGCTTTGGTCTTGGCTTGTGACTTTGAGCCCATGATACCACCACCCCACTTCTTCCTGACCTCATCGAACTTGTCGTTGAAGTTTGACTTAATGGCCTCCAAGATTTTGCTGAACTCCAACTTGTCTTCATTCTTCACAGTCGTCAGACAAAGGACAGATGCTGTCTTCTTGTGCACAATCGATCCAAGACGAGCCTTTCCCTTCACAATGCAATAAGGGATTTCCATCTTCCTGCACAAGGCTGGGAGCCAAACGACGAGTTCAATGGGGTCGACATCATGAGCAATGACCACAAGCTGTGCCTTGCTCTGTTCAATCAAATAGGTCACATGGTCAAGACCATACTTCACAACAATTGGTTTCTTGGCTTCAACAGTCTTCCCTTCAGCCTCTGCTTGCGCTCTTTTCAAAAGCCTTTCCTTCTGGCAGCCTTATCTTCAGGGCGGTACTTCAACAGCATCTTGAATAGATTAGTTGCGAGGTTCTTGTCGAGGGTGCGGGTGAACTGGTTGAGCGCGGGTGGAACCTTGAGGCGCTGCTTGAGGACGCGGCGCTGGCGCTGGATCCGCACCGCCTTGGGCCATCTGACGAAGCGGTGCAAGTCCTTCCTCGGCGGGAGCGCGCCGCCGATCCCGAACTGCTTCGGCCGCTTCTCGAACAGCGGGTTCACCGCCGCCGCCGCCGCCTTCTTCCTCGCCGGCACCGGCGCCTTCGCGCCTCTCTTCGGGGCCATCGCGGCGGCGCGCGGGATTGGAGGGAGGAAGTGGCGGCGCGGGAGGATTAACCCTAGGAAAGCTGTGGGATGGCGG
| Transcript ID | Chromosome | Locus | Ref | Alt |
|---|---|---|---|---|
| Osa01LNT0053600.1 | 1 | 40496933 | A | C |
| Osa01LNT0053600.1 | 1 | 40497262 | G | T |
| Osa01LNT0053600.1 | 1 | 40497336 | T | A |
| Osa01LNT0053600.1 | 1 | 40498017 | T | G |
| Osa01LNT0053600.1 | 1 | 40497169 | A | C |
| Osa01LNT0053600.1 | 1 | 40497988 | A | G |
| Transcript ID | MiRNA ID | Inhibition | Expectation | Score | Binding Start | Binding End |
|---|---|---|---|---|---|---|
| Osa01LNT0053600.1 | osa-miR396a-5p | Cleavage | 4.5 | 19.636 | 1 | 21 |
| Osa01LNT0053600.1 | osa-miR396b-5p | Cleavage | 4.5 | 19.636 | 1 | 21 |
| Osa01LNT0053600.1 | osa-miR396c-5p | Cleavage | 4.5 | 19.636 | 1 | 21 |
| Osa01LNT0053600.1 | osa-miR169q | Cleavage | 1.5 | 18.643 | 1 | 21 |
| Osa01LNT0053600.1 | osa-miR2102-3p | Cleavage | 4.5 | 17.069 | 1 | 22 |
| Transcript ID | Chr | QTL Gene | Character Major | Character Minor | Marker Interval1 | Marker Interval2 |
|---|---|---|---|---|---|---|
| Osa01LNT0053600.1 | 1 | brt1d | Resistance or Tolerance | Drought tolerance | C742 | C904 |
| Osa01LNT0053600.1 | 1 | FSM | Morphological trait | Shoot/Seedling | nan | nan |
| Osa01LNT0053600.1 | 1 | rrw1b | Resistance or Tolerance | Other soil stress tolerance | C86 | RG236 |
| Osa01LNT0053600.1 | 1 | nan | Morphological trait | Root | RG109 | RM104 |
| Osa01LNT0053600.1 | 1 | nan | Physiological trait | Eating quality | RM8084 | RM6827 |
| Osa01LNT0053600.1 | 1 | qRNd1 | Resistance or Tolerance | Other soil stress tolerance | RG236 | C86 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Other soil stress tolerance | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Morphological trait | Seed | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | fll1 | Morphological trait | Culm/leaf | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Other disease resistance | RG109 | RG236 |
| Osa01LNT0053600.1 | 1 | sd1 | Resistance or Tolerance | Drought tolerance | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | tn1-4 | Morphological trait | Culm/leaf | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | ph1 | Morphological trait | Dwarf | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Morphological trait | Root | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | qPHT-1 | Morphological trait | Dwarf | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RZ730 | RG810 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RG690 | RG810 |
| Osa01LNT0053600.1 | 1 | qNOP-1 | Morphological trait | Culm/leaf | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | Fh1-2 | Morphological trait | Dwarf | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | RG810 | RZ730 |
| Osa01LNT0053600.1 | 1 | qPL-1 | Morphological trait | Panicle/flower | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | pl1.1 | Morphological trait | Panicle/flower | RZ730 | RZ801 |
| Osa01LNT0053600.1 | 1 | nan | Resistance or Tolerance | Drought tolerance | C86 | RZ14 |
| Osa01LNT0053600.1 | 1 | yd1b | Morphological trait | Seed | C547 | C2340 |
| Osa01LNT0053600.1 | 1 | qPH1-1 | Morphological trait | Shoot/Seedling | C86 | RG236 |
| Osa01LNT0053600.1 | 1 | qRIE 1 | Resistance or Tolerance | Submergency tolerance | C86 | G54 |
| Osa01LNT0053600.1 | 1 | qPHT1-1 | Morphological trait | Dwarf | RZ730 | RG810 |
| Osa01LNT0053600.1 | 1 | sd-1 | Morphological trait | Dwarf | RZ730 | RG810 |
| Transcript ID | Pre-miRNA | Identity(%) | Alignment Length | Pre-miRNA start | Pre-miRNA end | E-value | Bitscore |
|---|
© Copyright 2019 Huazhong Agricultural University , Central China Normal University (School of Life Science, Central China Normal University)